Important Notice: Our web hosting provider recently started charging us for additional visits, which was unexpected. In response, we're seeking donations. Depending on the situation, we may explore different monetization options for our Community and Expert Contributors. It's crucial to provide more returns for their expertise and offer more Expert Validated Answers or AI Validated Answers. Learn more about our hosting issue here.

What use does the scrambled non-effective plasmid serve?

April 26, 2017non-effective plasmid scrambled serve

0

Posted

What use does the scrambled non-effective plasmid serve?

1 Answer

0

Posted

To specifically rule out the potential non-specific effect induced by expres-sion of the HuSH product, OriGene provides customers with a negative control (TR30012, TR30013 or TR30015), that was constructed by cloning a scrambled sequence cassette (5’ GCACTACCAGAGCTAACTCAGATAGTACT3’) into our pRS, pGFP-V-RS, or pRFP-C-RS vectors respectively. The plasmid should serve as a negative control for gene-specific knockdown experiments and exclude any potential interferon response.