What primer should I use to sequence my HuSH plasmids?
It is very difficult to sequence the shRNA constructs due to the hairpin structure. However, you can use DNA relaxation agents in the sequencing reaction (0.83 M Betaine [Sigma #B-0300] plus 1x PCRx Enhancer [in Invitrogen kit part # 11495-017]), which may be helpful. Our sequencing primer is located at the 3′ end of the cloning site and has the sequence 5`TTGAGATGCATGCTTTGCATAC3`.
