Important Notice: Our web hosting provider recently started charging us for additional visits, which was unexpected. In response, we're seeking donations. Depending on the situation, we may explore different monetization options for our Community and Expert Contributors. It's crucial to provide more returns for their expertise and offer more Expert Validated Answers or AI Validated Answers. Learn more about our hosting issue here.

What is the sequence of the non-silencing, GAPDH and EG5 control hairpins?

0
Posted

What is the sequence of the non-silencing, GAPDH and EG5 control hairpins?

0

GAPDH 22mer: cGCTCATTTCCTGGTATGACAA Non-silencing 22mer: aTCTCGCTTGGGCGAGAGTAAG EG5 Sequence 22mer: GGCCATGCTAGAAGTACATAA Aligns to: NM_004523.2 Homo sapiens kinesin family member 11 (KIF11), mRNA Length=4908

Related Questions

What is your question?

*Sadly, we had to bring back ads too. Hopefully more targeted.

Experts123