What can be the internal control for RT-PCR to investigate mRNA expression level during dicty development?
-Chikako Kitayama, National Institute of Advanced Industrial Science and Technology, Japan, 15 Apr 2002 • Since I received several e-mails wondering same question with me, I thought it would be good idea to put the answers to the mailing list. Because these answers were to my personal e-mail address, I deleted the signatures of kind senders, just in case. Thank you for those who replied to me. – Chikako Kitayama, 16 Apr 2002 • I have used the IG7 (rnlA) message as an internal control for RT-PCR. Below is the full sequence, the primers I used were : ttacatttattagacccgaaaccaagcg (forward primer bp 625-652) ttccctttagacctatggaccttagcg (reverse primer bp 992-966) annealing temp for PCR used was 57*C However you will need to use temperature matched primers to your other message so these exact primers may not work will for you. • Is this real-time or rev. transcriptase? You can use actin for reverse transcriptase. • We use the H7 (cinD) gene which is constitutively expressed at the same leve
