Important Notice: Our web hosting provider recently started charging us for additional visits, which was unexpected. In response, we're seeking donations. Depending on the situation, we may explore different monetization options for our Community and Expert Contributors. It's crucial to provide more returns for their expertise and offer more Expert Validated Answers or AI Validated Answers. Learn more about our hosting issue here.

What are the sequencing primers for the pTXB vectors?

April 26, 2017Primers ptxb sequencing vectors

0

Posted

What are the sequencing primers for the pTXB vectors?

1 Answer

0

Posted

The insert in a pTXB vector can be sequenced by the T7 Universal Primer (NEB#S1248), and Mxe intein reverse II primer (NEB#S1285, 5´ GATTGCCATGCCGGTCAAGG -3´), which anneals to the intein sequence 107 base pairs from the cleavage site and sequences in the orientation opposite to transcription.