What are HVR1 and HVR2?
egions of mitochondrial DNA. These regions each consist of about 570 nucleotides (i.e. Adenine, Cytosine, Guanine, and Thymine) and are fully sequenced as part of the analysis done when performing a mtDNA test. In 1981 researchers at Cambridge successfully sequenced the entire genome of a human mitochondrion. The sequence for this particular mitochondrion is now known as the Cambridge Reference Sequence (CRS) and is used as the reference to which all other mtDNA tests are compared. The CRS begins HVR1 as ATTCTAATTTAAACTATTCT…, with the first nucleotide having index 16001 (and the last one in HVR1 having index 16569). Any insertions, deletions, or alterations of nucleotide values are reported as mutations as compared against the Cambridge Reference Sequence. These three mutation types are reported with the following syntax: • An insertion (of a Cytosine nucleotide, for example) after position 16002 would be reported as 16002.1C (or just 2.
HVR stands for “Hypervariable Region.” There are two of them in mtDNA, and they are named this way because they tend to mutate more often here than in the coding region. They also contain no genes, which means that testing these regions provides information about a person’s ancestral origins on their maternal line (http://www.familytreedna.com/inheritance-chart.aspx) without revealing any health or medical conditions.
