Important Notice: Our web hosting provider recently started charging us for additional visits, which was unexpected. In response, we're seeking donations. Depending on the situation, we may explore different monetization options for our Community and Expert Contributors. It's crucial to provide more returns for their expertise and offer more Expert Validated Answers or AI Validated Answers. Learn more about our hosting issue here.

Can I use VP1.5 and XL39 for PCR amplication of my insert?

April 26, 2017insert PCR vp1.5 xl39

0

Posted

Can I use VP1.5 and XL39 for PCR amplication of my insert?

1 Answer

0

Posted

VP1.5, 5’ GGACTTTCCAAAATGTCG 3’ Tm=51C and XL39, 5’ ATTAGGACAAGGCTGGTGGG 3’ Tm=60C usually do not work well for amplification of the insert due to the large difference in their Tms. VP1.5 and XL39 are provided so that if you amplify the plasmid DNA, you can confirm your DNA prep by sequencing.